What Constitutes Plagiarism?

How to reference citations.

Biology 112 Fall 2011

Instructor: Dr. Beth Boyle

Laboratory location : M-1-114 & 116

Required Course Materials:

Text Books: Campbell et al. Biology 9th Edition (8th edition is fine)

A Photographic Atlas for the Biology Laboratory 6th Edition Van De Graaff and Crawley

An iClicker

Laboratory Manual: Quinn Graphics LL 024

Laboratories begin September 12th.

Your first lab is at Harvard's Museum of Natural History.

Students: Before your lab starts, you must purchase a lab manual at Quinn Graphics, located on the Lower Level (LL) of the Quinn Service Building (S/LL/024).(take the elevator to LL, take a left, a right and it is on your right) Get there before 5pm! Call Quinn Graphics for info @ 617-287-5020

Lecture Material

(Presentations posted prior to use in lecture are drafts and may be modified before they are used in lecture.)

Syllabus

Date Topic
Tu 9/6 Introduction and Evolution 1
Th 9/8 Evolution 2: Natural Selection
Tu 9/13

Evolution 3: Population Genetics I

Population Genetics handout (updated)

Notes for Lecture 3:
Today in class we will work through some population genetics problems.
You should take notes in class and I will post notes after class.
Th 9/15

Evolution 4: Population Genetics II

This presentation is a draft- it may be modified before class.
Tu 9/20 Evolution 5: Species and Taxonomy
Th 9/22 Evolution 7: Earth History
Tu 9/27 Evolution 6: Phylogeny and Molecular Data
Th 9/29 Themes1: Nutrition, Size and Scale
Tu 10/4 Themes 2: Respiration, Circulation & Reproduction
Th 10/6 EXAM I (Evolution and Themes)
Tu10/11 Prokaryotes, Protists, Fungi
Th 10/13 Plants 1: Mosses & Ferns
Tu 10/18 Plants 2: Gymnosperms and Angiosperms I
Th 10/20 Plant 3: Angiosperms II
Tu 10/25 Plant 4 : Plant Form and Function
Th 10/27 Animals 1: Introduction and Invertebrates
Tu 11/1 Animals 2: Invertebrates II
Th 11/3 EXAM II (Prokaryotes -Animal 2)
Tu 11/8 Animals 3: Vertebrates
Th 11/10 Animal Form and Function
Tu 11/15 Animal Behavior
Th 11/17 Ecology 1: Introduction
Tu 11/22 Ecology 2: Population Growth
Th 11/24

No Class Thanksgiving Holiday
Tu 11/29 Ecology 3: Interactions
Th 12/1 Ecology 4: Community Structure
Tu 12/6 EXAM III
Th 12/8 Ecology 5: Ecosystems
Tu 12/13 Ecology 6: Conesrvation Biology and Review

Final Exam period : 12/6-12/22 the date of the final exam will be announced in class when it is known.

112 Laboratory Syllabus

Try this version (click on this) if you have trouble opening Lab Manual Downloads listed below

Week of Lab Exercise
Prelab Assignment Due
Reports & Writeups
9/5/10 None
9/12/10 HMNH field trip
9/19/10

Skulls and Evolution & Molecular Phylogeny

The Phylogenetic Tree Constructor (animal and plant cytochrome c protein sequences)
The Mammalian Tree Constructor. (Mammalian Cytochrome Oxidase II sequences)

Construct Trees Ferns (using DNA sequences)
Flu-viruses (using DNA sequences)
Animals (using hemoglobin protein sequences) Vertebrates (using cytochrome c oxidase subunit 1 protein sequences)
yes
HMNH Field Trip questions (30pts)
9/26/10

Aipotu:Evolution

A sample DNA Sequence to use as a starting point for evolution: GTATAACCATGCATAGTGGTAAACATAGTGCGCGTAGGCATCAAAGGTCATTAACCGGGGGT

Download for home use
yes
Skulls & Evolution assignment/ Molecular phylogeny assignment (30pts)
10/3/10

Microbial Diversity

video link
yes
Aipotu: Evolution assignment (30pts)
10/10/10

Plant I Diversity: life cycles & Greenhouse Tour

Some Plant Images for review for the Lab Practical Exam (work in progress)
yes
10/17/10

Plant II Structure & Flower Dissection (continued)

(root growth set up)
10/24/10 Plant III Growth
yes
10/31/10

Animal Diversity I

Some Animal Images for review for the Lab Practical Exam (work in progress)
yes
Plant Growth Assignment (20pts)
11/7/10

Animal Diversity II

Trout and Squid Dissection
yes
11/14/10

Lab Practical Exam

(100pts)
11/21/10 None
11/28/10 Animal Behavior
yes
12/6/10

Phylogenetic Collection

Links to help you find organisms for your collection: NOTE: Use ONLY these sites when determining the phyla for your collection. No other sources are considered valid for this lab.
A list of Animal Phyla with links.
A list of Bacterial Phyla with links.
A list of Fungal Phyla with links.
A list of Plant Phyla with links.
A list of Protist Phyla with links.
The Taxonomy Site for the Lab DO NOT USE THIS WHEN MAKING YOUR COLLECTIONS!!! This is only for use DURING the lab session.

Animal Behavior Lab Report (20pts)

Phylogenetic Collection (20pts)
12/12/10 None
Phylogenetic Report (30pts)
   
80 points
280 points
   
360 points

 

 

  
Created Sept. 2007 Updated September 2011M Biology Department UMass Boston